Haplogroup Q or Q-M242 is a
Y-chromosome DNA haplogroup. It has one primary
subclade,
Haplogroup Q1 (L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations.
Q-M242 is believed to have arisen around the
Altai Mountains area (or
South Central Siberia),[3] approximately 17,000[3] to 31,700 years ago.[4] However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the
SNPs M242, P36.2, and MEH2 as defining mutations.
Technical specification of mutation
The polymorphism, “M242”, is a C→T transition residing in intron 1 (IVS-866) of the DBY gene and was discovered by Mark Seielstad et al. in 2003.[16]
The technical details of M242 are:
Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc
Subclades
In
Y chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by
single-nucleotide polymorphisms (SNPs) or
unique-event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available
phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.
Phylogenetic trees
There are several confirmed and proposed
phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the
Y Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in
Houston,
Texas. The
International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.
The 2015 ISOGG tree
The
subclades of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree[5] are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.
Below is a 2012 tree by Thomas Krahn of the
Genomic Research Center.[17] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[18]
This is the 2008 tree produced by the
Y Chromosome Consortium (YCC).[19] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[20] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.
The subclade (under Q-MEH2) proposed by Sharma (2007), which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human
arylsulfatase D pseudogene, is not represented in any current trees under Q-MEH2.[21] The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an
autochthonous differentiation to Q-ss4bp.[6]
Several branches of haplogroup Q-M242 have been predominant
pre-Columbian male lineages in
indigenous peoples of the Americas. Most of them are descendants of the major founding groups who migrated
from Asia into the Americas by crossing the
Bering Strait.[3] These small groups of founders must have included men from the
Q-M346,
Q-L54,
Q-Z780, and
Q-M3 lineages. In North America, two other Q-lineages also have been found. These are
Q-P89.1 (under Q-MEH2) and
Q-NWT01. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.
It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Regardless, Q-M242 came to dominate the paternal lineages in the Americas.
North America
In the indigenous people of North America, Q-M242 is found in
Na-Dené speakers at an average rate of 68%. The highest frequency is 92.3% in
Navajo, followed by 78.1% in
Apache,[3] 87%[3] in SC Apache,[22] and about 80% in North American
Eskimo (
Inuit,
Yupik)–
Aleut populations. (Q-M3 occupies 46% among Q in North America)[23]
On the other hand, a 4000-year-old
Saqqaq individual belonging to Q1a-MEH2* has been found in
Greenland. Surprisingly, he turned out to be genetically more closely related to Far East Siberians such as
Koryaks and
Chukchi people rather than Native Americans.[24] Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in
Greenland, showing the highest in east
Sermersooq at 82% and the lowest in
Qeqqata at 30%.[13]
Q-M242 is estimated to occupy 3.1% of the whole US population in 2010:[25]
5.3% (13/246 in 8 provinces in northeastern, central, southern regions)[36] to 23.4% (181/775 in 8 provinces in central-west, central, northwest regions)[37] in
Argentina,
In
Siberia, the regions between
Altai and
Lake Baikal, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study (Dulik 2012),[51] Q-M242 (mostly Q-M346 including some Q-M3) has been found in 24.3% (46/189: 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them,
Chelkans show the highest frequency at 60.0% (15/25: all Q-M346), followed by
Tubalars at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120).
In a former study, Q-M242 is found in 4.2% of southern
Altaians and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples.[11] In another study,[52] the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.
Tuva, which is located on the east side of
Altai Republic and west of
Lake Baikal as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 14%[53]~38.0% (41/108)[52] of
Tuvans. Also, Todjins (
Tozhu Tuvans) in eastern Tuva show the frequency at ≤22.2% (8/36 P(xR1)[54])~38.5% (10/26, all Q-M346(xM3)).[52] So, the average frequency of Q-M242 among Tuvans-Todjins in Tuva Republic is about 25%. Haplogroup Q-M242 has been found in 5.9% (3/51) of a sample of Tuvans from the village of Kanasi, 9.8% (5/51) of a sample of Tuvans from the village of Hemu, and 62.5% (30/48) of a sample of Tuvans from the village of Baihaba in northern
Xinjiang near the international border with
Altai Republic.[12]
The highest frequencies of Q-M242 in Eurasia are witnessed in
Kets (central Siberia) at 93.8% (45/48) and in
Selkups (north Siberia) at 66.4% (87/131).[7] Russian ethnographers believe that their ancient places were farther south, in the area of the
Altai and
Sayan Mountains[3] (
Altai-Sayan region). Their populations are currently small in number, being just under 1,500 and 5,000 respectively. In
linguistic anthropology, the Ket language is significant as it is currently the only surviving one in the
Yeniseian language family which has been linked by some scholars to the
Native AmericanNa-Dené languages[55] and, more controversially, the
language of the Huns. (See: L. Lieti, E. Pulleybank,[56]E. Vajda,[57] A. Vovin,[58] etc.)
Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346),
Khakassians (6.3%, Q-M346),
Kalmyks (3.4%, Q-M25, Q-M346)[52] and
Khanty,[59] and so on.
In some studies, various subgroups of Q-M242 are observed in
Mongolia. Q1a2-M346 (mostly Q-L330) occupies 1.4[29]~3.1%[50] of
Mongols (1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25[29]~1.25%[50]), Q1a1b-M25 (0.25[29]~0.63%[50]), Q1b-M378. In another study, Q is found in 4% of Mongols.[8] Karafet et al. (2018) found Q-L54(xM3) in 2.7% (2/75) and Q-M25 in another 2.7% (2/75) for a total of 5.3% (4/75) haplogroup Q Y-DNA in a sample of Khalkha Mongols from Ulaanbaatar, Mongolia.[60] Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%.
However, most of Q-M242 people in
East Asia belong to subclade Q-M120, which distributes most intensively across northern
China (the provinces of which the capitals locate northern to
Huai River-
Qin Mountains line). Q-M242 ranged from 4~8% in
northwest China (
Xinjiang,
Gansu,
Shaanxi),
north China (
Shanxi,
Hebei),
central China (
Henan), and upper
east China (
Shandong) to 3~4% in
northeast China. The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China.[43][44] In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China.[61] In another study published in 2011, Hua Zhong et al. found haplogroup Q-M242 in 3.99% (34/853, including 30/853 Q-M120, 3/853 Q-M346, and 1/853 Q-M25) of a pool of samples of Han Chinese from northern China and 1.71% (15/876, including 14/876 Q-M120 and 1/876 Q-M346) of a pool of samples of Han Chinese from southern China.[62] Q1a1-M120 is unique to East Asians. It is not found in South east Asia except with low diversity in Y-STR among southern Han Chinese indicating it spread during the Neolithic with Han Chinese culture to southern China from northern China. Q1a3*-M346 is only found among Hui and southern Han Chinese in South East Asia in southern China but not found in non-Han indigenous peoples at all. It came from northern China (north east Asia) with the Han. Only Native Americans have Q1a3a-M3, which is a descendant haplogroup of Q1a3*-M346. The Americas was populated by migrants from Central Asia in prehistoric times.[63] Q1a1 is attested in over 3,000 year old Han Chinese ancestral remains in the Shang and Zhou dynasties from the Hengbei archeological site.[64] Modern northern Han Chinese Y haplogroups and mtdna match those of ancient northern Han Chinese ancestors 3,000 years ago from the Hengbei archeological site. 89 ancient samples were taken. Y haplogroups O3a, O3a3, M, O2a, Q1a1, and O* were all found in Hengbei samples.[65]
Q-M242 has been found with notable frequency in some samples of
Uyghurs: 15.38% (22/143, including 6/143 Q-M378, 5/143 Q-P36.2*, 4/143 Q-M120, 4/143 Q-M346, 1/143 Q-M25) of a sample of Uyghurs from the Turpan area (吐鲁番地区),[66] 7.9% (6/76, including 2/76 Q1b1-L215/Page82/S325, 1/76 Q1a2-M346*, 1/76 Q1a1a1-M120, 1/76 Q1a2a1c-L330*, 1/76 Q1a2a1c1-L332) of a sample of Dolan Uyghurs (刀郎人) from Horiqol Township of Awat County,[67] and 7.74% (37/478, including 24/478 Q-M346, 7/478 Q-P36.2*, 5/478 Q-M120) of a sample of Uyghurs from the Hotan area (和田地区).[68] However, other studies have found haplogroup Q in much smaller percentages of Uyghur samples: 3.0% (2/67) Q-P36 Uygur,[69] 1.6% (1/64) Q-M120 Lop Uyghur (罗布人).[67] Haplogroup Q was not observed in a sample of 39 Keriyan Uyghurs (克里雅人) from the village of Darya Boyi, located on the Keriya River deep in the Taklamakan Desert.[67]
Haplogroup Q was observed in 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in
Tibet in one study[45] and in 1.23% (29/2354) of males in Tibet in another study,[70] but this haplogroup was not observed in a sample of males from Tibet (n=105) in a third study.[69]
Subclade Q1b-M378 is also found in
China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in
Japan.[79]
Southeast Asia
Haplogroup Q shows low frequencies in
Southeast Asia. In a study,[46] the frequencies of haplogroup Q is 5.4% (2/37) in
Indonesia, 3.1% (2/64) in the
Philippines, 2.5% (1/40) in
Thailand. However, other studies show 0% or near 0% frequencies in those countries.[48]
In the case of
Vietnam, the frequency is 7.1% in one study of a sample of Vietnamese reported to be from southern Vietnam[80][81] and 4.3% in a sample of
Kinh people from
Ho Chi Minh City in southern Vietnam,[77] but 0% or under 1% in other studies in which samples have been collected in
Hanoi in northern Vietnam.[46][81][48] So, it is hard to define average frequencies. However, Macholdt et al. (2020) have tested a sample of fifty
Kinh people from northern Vietnam (all but one of whom are from the
Red River Delta region, and 42 of whom are from
Hanoi) and found that two of them (4%) belong to Q-M120.[82]
Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in
Myanmar, and all the Q samples are concentrated in 18.8% in
Ayeyarwady (2/11) and 7.1%
Bago (1/14) regions in southwest Myanmar.[83] And, Q-M242 is found in 55.6% (15/27) in the
Akha tribe in northern
Thailand.[48]
Central Asia
In
Central Asia, the southern regions show higher frequencies of Q than the northern ones.
In the northern regions, Q-M242 is found in about 2%[84]~6%[85][86] (average 4%) of
Kazakhs. A study published in 2017 found haplogroup Q Y-DNA in 3.17% (41/1294) of a large pool of samples of
Kazakh tribes; however, haplogroup Q was concentrated in the members of the
Qangly tribe (27/40 = 67.5%), and it was much less common among the other tribes.[87] The Qangly tribe is related at least in name to the earlier
Kankalis and probably also the
Kangar union. Haplogroup Q is found in about 2% of
Kyrgyz people.[50][85][86]
In the southern regions, Q-M242 is found in 5%[88]~6%[85][86] of
Tajiks (
Tajikistan). Karafet et al. 2001 found P-DYS257(xQ1b1a1a-M3, R-UTY2), which should be roughly equivalent to haplogroup Q-M242(xM3), in 4/54 = 7.4% of a sample of
Uzbeks, apparently sampled in Uzbekistan.[89] Wells et al. 2001 found P-M45(xM120, M124, M3, M173), which should be roughly equivalent to a mix of Q-M242(xM120, M3) and R2-M479(xR2a-M124), in 20/366 = 5.5% of a pool of samples of Uzbeks from seven different regions of Uzbekistan.[85] Di Cristofaro et al. 2013 found Q-M242 in 11/127 = 8.7% of a pool of samples of Uzbeks from three different provinces of Afghanistan, including 5/94 Q-M242(xM120, M25, M346, M378), 4/94 Q-M346, and 1/94 Q-M25 (10/94 = 10.6% Q-M242 total) in a sample of Uzbeks from
Jawzjan Province, whose northern border abuts the southeastern corner of
Turkmenistan, and 1/28 Q-M242(xM120, M25, M346, M378) in a sample of Uzbeks from
Sar-e Pol Province.[50] Wells et al. (2001) found P-M45(xM120, M124, M3, M173) in 10.0% (3/30) of a sample of
Turkmens from
Turkmenistan, whereas Karafet et al. (2018) found Q-M25 in 50.0% (22/44) of another sample of Turkmens from Turkmenistan, so the frequency of haplogroup Q in that country is not yet clear. However, Grugni et al. (2012) found Q-M242 in 42.6% (29/68) of a sample of Turkmens from
Golestan, Iran, and Di Cristofaro et al. (2013) found Q-M25 in 31.1% (23/74) and Q-M346 in 2.7% (2/74) for a total of 33.8% (25/74) Q-M242 in a sample of Turkmens from
Jawzjan, Afghanistan, so the frequency of Q-M242 may reach about 40% in
Turkmens of
Afghanistan and
Iran who live in the areas adjacent to Turkmenistan.
Q-M242 accounts for 6.9% of
Afghans in a study (Haber 2012). In another study (Cristofaro 2013) with a larger sampling, the frequency of Q rises to 8.9% (45/507). Haplogroup Q occurs at a frequency of 8% (11/136) in Afghan
Pashtuns and 3% (5/142) in Afghan
Tajiks.[90][91] In this study(Cristofaro 2013),
Turkmens of
Jowzjan Province which is neighboring to
Turkmenistan show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by
Uzbeks at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346).[50]
Southwest Asia
Southwest Asia exhibits high frequencies of Q in northern
Iran, and gradually lowering ones to the southwest.
Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in
Turkmens of
Golestan, followed by 9.1% in
Isfahan (
Persian people), 6.8% in
Khorasan (Persian people), 6% in
Lorestan (Luristan,
Lurs), 4.9% in
Azarbaijan Gharbi (5.1% of
Assyrians and 4.8% of
Azeris), 4.5% in
Fars (Persian people), and so on.[92] Turkmens are known as the descendants of
Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.[93][94][95]
In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in
Iraqis (x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in
Marsh Arabs who are known as the descendants of ancient
Sumerians.[96]
Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in
Saudi Arabia belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the
United Arab Emirates and 0.8% (1/121: Q*) in
Oman peoples.[97][98]
Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36)
Syrians[80] and 2.0% (18/914, 14 Q*, 4 Q-M25) in
Lebanese.[99]
Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in
Turkey belong to haplogroup Q.[100] In a study (Gokcumen 2008), it was found that among
Turks who belong to the
Afshar tribe (one of
Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.[101]
South Asia
In
Pakistan at the eastern end of the
Iranian Plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[102]~3.4% (6/176).[103]
In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of
Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006, Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples.[6] (For more information, see
Y-DNA haplogroups in populations of South Asia)
In a regional study in
Gujarat (
Western India), Q-M242 was found at its highest 12% (3/25) among Nana Chaudharis while the overall percentage in Gujarat was found to be 2.8% (8/284).[104] In another study, 2.6% of Tharus in Chitwan district and 6.1% (3/49) of Hindus in
New Delhi, the capital of
India were found to be Q-M242 positive.[105]
In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237:
Chakma 13/89,
Marma 4/60,
Tripura 6/88) in three ethnic groups of
Bangladesh.[106] In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242.
The
Caucasus region shows a frequency at 1.2% in a study,[94] but it may reach over 4% in
Azerbaijan, in that 4.9% of the neighboring
Iranian Azerbaijanis harbor Q-M242.[93] It is 1.3% in
Georgians and
Armenians respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.[118]
Northern Europe
In
Northern Europe, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of
Swedish males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region (
Götaland,: not to be confused with
Gotland), and rarely to the north. If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.
In
Norway, Q-M242 is found in about 2.6% (~4%[119]) of males, with Q-L804 being more common than Q-F1161/L527.[120] It is observed among 1.6% of males in
Denmark, 3% in the
Faroe Islands (known to be related to
Vikings).[121] In an article (Helgason et al.) on the haplotypes of
Icelanders, 7.2% (13/181) of males in
Iceland are labelled as R1b-Branch A, but they are actually Q-M242.[119][122] On the other hand, it is 0.2% in
Finland,[123] 4.6% in
Latvia,[124] 1.1% in
Lithuania,[125] 0.5% in
Estonia.
Western Europe
In
Western Europe, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as
Germany,
France,
United Kingdom, etc., but some regions show a little higher. It is 2.1% in
Switzerland,[126] and it reaches 5.1% in
Lyon (
Rhône-Alpes) region of France.[127] It is about 4% in
Shetland of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of
Vikings. And, surprisingly, Q-M242 in Shetland (also in some areas of
Scandinavia, Faroe Islands, Iceland, and the United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia. Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of
Azeris (
Azerbaijan).[119]
Southern Europe
Southern Europe also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland
Croatia, but it reaches 14.3% (13/91) in
Hvar Islands and 6.1% (8/132) in
Korčula.[127] Also, it is about 0.6% in
Italy, but it rises to 2.5% (6/236) in
Sicily, where it reaches 16.7% (3/18) in
Mazara del Vallo region, followed by 7.1% (2/28) in
Ragusa, 3.6% in
Sciacca,[128] and 3.7% in
Belvedere Marittimo.[129]
On the other hand, according to a study (Behar 2004), 5.2% (23/441) of
Ashkenazi Jewish males belong to haplogroup Q-P36.[130] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3% (4/174)[131]~5.6% (3/53)[132] of
Sephardi Jews are in haplogroup Q.
Africa
Haplogroup Q is rarely found across
North Africa. It is observed in 0.7% (1/147),[98] of
Egyptians and in 0.6% (1/156)[94] of
Algerian people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from
Comoros which is located in between
East Africa and
Madagascar.
To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.
Q-P36.2 (P36.2) Found with low frequency in
Iran.[135]
Q-MEH2 (MEH2) Was found in
Koryaks (at 10.3%), although the level of STR diversity associated with Q-MEH2 is very low, this lineage appears to be closest to the extinct
Paleo-Eskimo individuals belonging to the
Saqqaq culture arisen in the New World Arctic about 5.5 Ka.[136]
Q-M378 (M378) — It is widely distributed in Europe, South Asia, West and East Asia. It is found among samples of
Hazaras and
Sindhis.[103] It is also found in the
Mongols, the
Japanese people and the
Uyghurs of North-Western
China in two separate groups.[145] The Q-M378 subclade is a branch to which Q-M242 men in some European Jewish Diaspora populations belong. Its subbranch Q-L245's subclades Q-Y2200 and Q-YP1035 are found in
Ashkenazi Jews.[146] Some
Sephardic Jews carry other subclades of Q-L245, including Q-BZ3900, Q-YP745, and Q-YP1237. Q-M378 samples also have been located in
Central America (
Panama) and
South America (
Andean Region)[29]
Hengbei site (Peng kingdom cemetery of
Western Zhou period),
Jiang County,
Shanxi, 2800-3000YBP: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O*[153]
In another paper, the social status of those human remains of ancient Peng kingdom(倗国) are analyzed. aristocrats: 3 Q1a1 (prostrate 2, supine 1), 2 O3a (supine 2), 1 N (prostrate) / commoners : 8 Q1a1 (prostrate 4, supine 4), 3 O3a (prostrate 1, supine 2), 3 O* (supine 3) / slaves: 3 O3a, 2 O2a, 1 O*[154]
(cf) Pengbo (倗伯), Monarch of Peng Kingdom is estimated as Q-M120.
Pengyang County,
Ningxia, 2500YBP: all 4 Q1a1-M120[153] (with a lot of animal bones and bronze swords and other weapons, etc.)
Heigouliang,
Xinjiang, 2200YBP: 6 Q1a* (not Q1a1-M120, not Q1a1b-M25, not Q1a2-M3), 4 Q1b-M378, 2 Q* (not Q1a, not Q1b: unable to determine subclades):[155]
In a paper (Lihongjie 2012), the author analyzed the Y-DNAs of the ancient male samples from the 2nd or 1st century BCE cemetery at
Heigouliang in Xinjiang – which is also believed to be the site of a summer palace for
Xiongnu kings – which is east of the Barkol basin and near the city of
Hami. The Y-DNA of 12 men excavated from the site belonged to Q-MEH2 (Q1a) or Q-M378 (Q1b). The Q-M378 men among them were regarded as hosts of the tombs; half of the Q-MEH2 men appeared to be hosts and the other half as sacrificial victims.
In L. L. Kang et al. (2013), three samples from a Xiongnu) site in
Barkol, Xinjiang were found to be Q-M3 (Q1a2a1a1). And, as Q-M3 is mostly found in Yeniseians and Native Americans, the authors suggest that the Xiongnu had connections to speakers of the
Yeniseian languages.[156][157] These discoveries from the above papers (Li 2012, Kang et al., 2013) have some positive implications on the not as yet clearly verified theory that the Xiongnu were precursors of the
Huns.
Mongolian noble burials in the
Yuan dynasty, Shuzhuanglou Site, northernmost
HebeiChina, 700YBP: all 3 Q (not analysed subclade, the principal occupant Gaodangwang Korguz (高唐王=趙王 阔里吉思)’s mtDNA=D4m2, two others mtDNA=A)[158]
(cf)
Korguz was a son of a princess of
Kublai Khan (元 世祖), and was the king of the
Ongud tribe. He died in 1298 and was reburied in Shuzhuanglou in 1311 by his son. (Do not confuse this man with the Uyghur governor,
Korguz who died in 1242.) The Ongud tribe (汪古部) was a descendant of the
Shatuo tribe (沙陀族) which was a tribe of
Göktürks (
Western Turkic Khaganate) and was prominent in the
Five Dynasties and Ten Kingdoms period of China, building three dynasties. His two queens were all princesses of the Yuan dynasty (Kublai Khan's granddaughters). It was very important for the Yuan dynasty to maintain a marriage alliance with Ongud tribe which had been a principal assistant since
Genghis Khan's period. About 16 princesses of the Yuan dynasty married kings of the Ongud tribe.
^Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91.
doi:
10.1002/humu.22468.
PMID24166809.
S2CID23291764.
^ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
^ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a).
^K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik op. cit.;
YFull YTree v5.08, 2017, "K-M2335", and;
PhyloTree, 2017, "Details of the Y-SNP markers included in the minimal Y tree" (Access date of these pages: 9 December 2017)
^ Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.
^Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008).
"Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas"(PDF). American Journal of Human Genetics. 82 (3): 583–592.
doi:
10.1016/j.ajhg.2007.11.013.
PMC2427228.
PMID18313026. Retrieved 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
^
abcdKarafet, T. M. (2002). "High Levels of Y-Chromosome Differentiation among Native Siberian Populations and the Genetic Signature of a Boreal Hunter-Gatherer Way of Life". Human Biology. 74 (6): 761–789.
doi:
10.1353/hub.2003.0006.
PMID12617488.
S2CID9443804.
^Zegura Stephen L., Tatiana M. Karafet, Lev A. Zhivotovsky, Michael F. Hammer. High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas, 2004.
^
abcdeKharkov, V. N.; Stepanov, V. A.; Medvedeva, O. F.; Spiridonova, M. G.; Voevoda, M. I.; Tadinova, V. N.; Puzyrev, V. P. (2007). "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups". Genetika. 43 (5): 675–687.
doi:
10.1134/S1022795407050110.
PMID17633562.
S2CID566825.
^"Y-DNA Haplotree". Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
^That is because it is a value for the
STRDYS435 with a value of 8→9 within haplogroup Q-M242 and the trend is to include only binary markers in phylogenetic trees. However, these are from studies where all current branches of the Q-M242 tree have not been tested. The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.
^
abHammer; et al. (Dec 2006). "Population structure of Y chromosome SNP haplogroups in the United States and forensic implications for constructing Y chromosome STR databases". Forensic Sci. Int. 164 (1): 45–55.
doi:
10.1016/j.forsciint.2005.11.013.
PMID16337103.
^Vullo, Carlos; et al. (2014). "Association between Y haplogroups and autosomal AIMs reveals intra-population substructure in Bolivian populations". Int J Legal Med. 129 (4): 673–680.
doi:
10.1007/s00414-014-1025-x.
PMID24878616.
S2CID2906322.
^Rojas, Win; et al. (2010). "Genetic Make Up and Structure of Colombian Populations by Means of Uniparental and Biparental DNA Markers". American Journal of Physical Anthropology. 143 (1): 13–20.
doi:
10.1002/ajpa.21270.
PMID20734436.=> (DANE, 2006) 86% of the whole Colombian population self-reported as of Mixed Ancestry, 3.4% as Native American, 10.5% as African-Columbian. In this paper, 12% (114/954) of MA, 95.7% (135/141) of NA, and 23.8% (5/21) of AC are turned out to be Y-DNA Q. Thus, 86*0.12+3.4*0.957+10.5*0.238=16.1%
^Núñez, Carolina; et al. (2012). "Y chromosome haplogroup diversity in a Mestizo population of Nicaragua". Forensic Sci. Int. Genet. 6 (6): e192–e195.
doi:
10.1016/j.fsigen.2012.06.011.
PMID22770600. The author revised his previous paper, genotyping 2 more samples as haplogroup Q by Y-SNP test.
^
abJeffrey, T.; et al. (Jan 2002).
"The Dual Origin and Siberian Affinities of Native American Y Chromosomes". The American Journal of Human Genetics. 70 (1): 192–206.
doi:
10.1086/338457.
PMC384887.
PMID11731934. The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups in the paper, R1-M173 is harbored only in some eastern Siberian Udegeys and Koryaks and Native Americans. Also, R2 (distributed in India and its neighbours) cannot be found in far east Siberia. Thus, P-M45 except some samples mentioned above virtually means Q-M242 (xM3). In the paper, 35.3% of Nivkhs and 20.8% of Chukchi people and 18.2% of Siberian Eskimos are shown in P-M45, and 12.5% of Chukchis and 21.2% of Siberian Eskimos are in Q-M3. All of them can be estimated to be in haplogroup Q.
^
abPakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–353.
doi:
10.1007/s00439-006-0213-2.
PMID16845541.
S2CID31651899.
^Derenko, Miroslava; Malyarchuk, Boris; Denisova, Galina A.; et al. (2006). "Contrasting patterns of Y-chromosome variation in South Siberian populations from Baikal and Altai-Sayan regions". Hum Genet. 118 (5): 591–604.
doi:
10.1007/s00439-005-0076-y.
PMID16261343.
S2CID23011845.
^E. J. VAJDA, "Siberian Link with Na-Dene Languages." The Dene–Yeniseian Connection, ed. by J. Kari and B. Potter(2010), pp.33–99, Anthropological Papers of the University of Alaska, new series, vol. 5(2010), Fairbanks: University of Alaska Fairbanks, Department of Anthropology
^E. G. Pulleyblank, "The consonontal system of old Chinese" [Pt 1], Asia Major, vol. IX (1962), pp. 1–2
^E. J. Vajda, Yeniseian Peoples and Languages: A History of Yeniseian Studies with an Annotated Bibliography and a Source Guide (2013, Oxford/New York, Routledge) pp.103-106, etc.
^"Did the Xiong-nu speak a Yeniseian language?". Central Asiatic Journal. 44 (1): 87–104. 2000.
^Lu Yan (2011), "Genetic Mixture of Populations in Western China." Shanghai: Fudan University, 2011: 1-84. (Doctoral dissertation in Chinese: 陆艳, “中国西部人群的遗传混合”, 上海:复旦大学,2011: 1-84.)
^
abcLIU, Shuhu; NIZAM, Yilihamu; RABIYAMU, Bake; ABDUKERAM, Bupatima; DOLKUN, Matyusup (February 2018). "应用Y染色体SNP对新疆三个隔离人群遗传多样性的研究 - 中国知网" [A study of genetic diversity of three isolated populations in Xinjiang using Y-SNP]. Acta Anthropologica Sinica (in Chinese). 37 (1): 146–156.
doi:
10.16359/j.cnki.cn11-1963/q.2017.0067.
^Shan; et al. (Sep 2014). "Genetic polymorphism of 17 Y chromosomal STRs in Kazakh and Uighur populations from Xinjiang, China". Int J Legal Med. 128 (5): 743–4.
doi:
10.1007/s00414-013-0948-y.
PMID24398978.
S2CID23248209.
^Jin Park, Myung; et al. (2012). "Understanding the Y chromosome variation in Korea-relevance of combined haplogroup and haplotype analyses". International Journal of Legal Medicine. 126 (4): 589–599.
doi:
10.1007/s00414-012-0703-9.
PMID22569803.
S2CID27644576.
^The frequencies of Q-M242 shown in both studies (Kim2010, Park2012) are 1.4% (7/506, Kim) and 1.8% (13/706, Park) respectively. But, if recalculated by regional population weights, the adjusted frequencies reach 1.87% (Kim) and 1.91% (Park) respectively, converging to 1.9%.
^Peter A. Underhill, Peidong Shen, Alice A. Lin, et al. (2000), "Y chromosome sequence variation and the history of human populations." Nature Genetics, Volume 26, November 2000.
^
abcKarafet, TM; et al. (Feb 2005). "Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders". Hum. Biol. 77 (1): 93–114.
doi:
10.1353/hub.2005.0030.
hdl:1808/13586.
PMID16114819.
S2CID7953854.
^
abEnrico Macholdt, Leonardo Arias, Nguyen Thuy Duong, et al., "The paternal and maternal genetic history of Vietnamese populations." European Journal of Human Genetics (2020) 28:636–645.
https://doi.org/10.1038/s41431-019-0557-4
^Turspekov; et al. (2012). "The Kazakhstan DNA project hits first hundred Y-profiles for ethnic Kazakhs". The Russian Journal of Genetic Genealogy. 2: 1.
^
abcdefWells, R. Spencer; Yuldasheva, Nadira; Ruzibakiev, Ruslan; Underhill, Peter A.; Evseeva, Irina; Blue-Smith, Jason; Jin, Li; Su, Bing; Pitchappan, Ramasamy; Shanmugalakshmi, Sadagopal; Balakrishnan, Karuppiah; Read, Mark; Pearson, Nathaniel M.; Zerjal, Tatiana; Webster, Matthew T.; Zholoshvili, Irakli; Jamarjashvili, Elena; Gambarov, Spartak; Nikbin, Behrouz; Dostiev, Ashur; Aknazarov, Ogonazar; Zalloua, Pierre; Tsoy, Igor; Kitaev, Mikhail; Mirrakhimov, Mirsaid; Chariev, Ashir; Bodmer, Walter F. (28 August 2001).
"The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proceedings of the National Academy of Sciences of the United States of America. 98 (18): 10244–10249.
Bibcode:
2001PNAS...9810244W.
doi:10.1073/pnas.171305098.
PMC56946.
PMID11526236.
^E. E. Ashirbekov, D. M. Botbaev, A. M. Belkozhaev, A. O. Abayldaev, A. S. Neupokoeva, J. E. Mukhataev, B. Alzhanuly, D. A. Sharafutdinova, D. D. Mukushkina, M. B. Rakhymgozhin, A. K. Khanseitova, S. A. Limborska, and N. A. Aytkhozhina, "Distribution of Y-Chromosome Haplogroups of the Kazakh from the South Kazakhstan, Zhambyl, and Almaty Regions." Reports of the National Academy of Sciences of the Republic of Kazakhstan, ISSN 2224-5227, Volume 6, Number 316 (2017), 85 - 95.
^The frequency of Q is 4% (6/150, all Q-M25) in Regueiro 2006, in which it is 9.1% (3/33) in north Iran and 2.6% (3/117) in south Iran. But, since more people live in the northern regions, if recalculated by population weights, the frequency will reach about 6%. It is also 6.2% (35/566) in Bekada 2013 with a large-scale sampling.
^Malyarchuk, B. A.; et al. (2008). "Gene Pool Structure of Russian Populations from the European Part of Russia Inferred from the Data on Y Chromosome Haplogroups Distribution". Russian Journal of Genetics. 44 (2): 187–192.
doi:
10.1134/S1022795408020105.
S2CID28165493.
^Csányi, B.; et al. (July 2008). "Y-Chromosome Analysis of Ancient Hungarian and Two Modern Hungarian-Speaking Populations from the Carpathian Basin". Annals of Human Genetics. 72 (4): 519–534.
doi:
10.1111/j.1469-1809.2008.00440.x.
PMID18373723.
S2CID13217908.
^Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.
^Behar, DM; et al. (Mar 2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Hum Genet. 114 (4): 354–65.
doi:
10.1007/s00439-003-1073-7.
PMID14740294.
S2CID10310338.
^Monika Karmin, Lauri Saag, Mário Vicente, et al. (2015), "A recent bottleneck of Y chromosome diversity coincides with a global change in culture." Genome Research 25:1–8. Published by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/15; www.genome.org.
^Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60.
doi:
10.1002/humu.20077.
PMID15300852.
S2CID1571356. Q-M323 in 3/20=15% of a sample of Yemenite Jews.
^Rasmussen, Morten; Sikora, Martin; Albrechtsen, Anders; Korneliussen, Thorfinn Sand; Moreno-Mayar, J. Víctor; Poznik, G. David; Zollikofer, Christoph P. E.; Ponce De León, Marcia S.; Allentoft, Morten E.; Moltke, Ida; Jónsson, Hákon; Valdiosera, Cristina; Malhi, Ripan S.; Orlando, Ludovic; Bustamante, Carlos D.; Stafford, Thomas W.; Meltzer, David J.; Nielsen, Rasmus; Willerslev, Eske (2015).
"The ancestry and affiliations of Kennewick Man". Nature. 523 (7561): 455–458.
Bibcode:
2015Natur.523..455R.
doi:
10.1038/nature14625.
PMC4878456.
PMID26087396.
^Hollard et al., Strong genetic admixture in the Altai at the Middle Bronze Age revealed by uniparental and ancestry informative makers, Forensic Science International: Genetics, published online 4 June 2014
^
abOn Henbei, Pengyang, and Heigouliang, Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
^Zhao, Yong-Bin; Zhang, Ye; Li, Hong-Jie; Cui, Ying-Qiu; Zhu, Hong; Zhou, Hui (November 2014). "Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixed into the Han Chinese 3,000 years ago". American Journal of Human Biology. 26 (6): 813–821.
doi:
10.1002/ajhb.22604.
PMID25130911.
S2CID20553478.
^Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
^L. L. Kang et al., Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families (2013)
^Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008
Behar, Doron M.; Garrigan, Daniel; Kaplan, Matthew E.; Mobasher, Zahra; Rosengarten, Dror; Karafet, Tatiana M.; Quintana-Murci, Lluis; Ostrer, Harry; et al. (2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Human Genetics. 114 (4): 354–65.
doi:
10.1007/s00439-003-1073-7.
PMID14740294.
S2CID10310338.
Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics. 71 (Pt 4): 480–95.
doi:
10.1111/j.1469-1809.2006.00343.x.
hdl:10130/491.
PMID17274803.
S2CID1041367.
Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia* genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–53.
doi:
10.1007/s00439-006-0213-2.
PMID16845541.
S2CID31651899.
Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60.
doi:
10.1002/humu.20077.
PMID15300852.
S2CID1571356.
Wells, Spencer (2002). The Journey of Man* A Genetic Odyssey. Random House.
ISBN978-0-8129-7146-0.